A Algorithms and Computational Biology Lab

Home > Projects > FLAT

FLAT - Flowgram Alignment Tool

Supplementary Information

This web page contains supplementary information for the paper "A probabilistic method for small RNA flowgram matching," Vladimir Vacic, Hailing Jin, Jian-Kang Zhu and Stefano Lonardi, Pacific Symposium on Biocomputing, PSB'08.

A Supplementary Figure 2
B Supplementary Figure 2
C Supplementary Figure 2

Supplementary Figure 1. Distributions of signal strengths for three 454 pyrosequencing datasets: A) A. thaliana (50 million flows, small RNA discovery); B) H. sapiens (38.4 million flows, small RNA discovery); C) C. bifermentans (188.9 million flows, whole-genome sequencing). The overlaps between Gaussians for different polynucleotide lengths are responsible for over-calling or under-calling the lengths of incorporated nucleotide runs.

It is of interest to observe that in the H. sapiens dataset, the means of Gaussians for length 5 poly-C,G,T have been skewed towards lower values. Also, peaks for 7 poly-A,T are higher than the peaks for 6 poly-A,T, which implies that in the sample there are more 7-mers than 6-mers - which is clearly not possible.

Supplementary Figure 2

Supplementary Figure 2. Flowspace encoding of the sequence CCGAACCTTAGCTCAGTTGG: the second line shows run-length encoding (RLE) of the sequence, and the third line shows insertions of dummy negative flows (gray lower case letters). The flowspace encoding is the output of an ideal sequencer, which does not make mistakes in terms of lengths of polynucleotides.

Supplementary Figure 3

Supplementary Figure 3. Combinations of negative flows which may flank a subsequence (the capital letters signify appropriately padded run length encoding of the sequence database, and lower case letters signify negative flows). Here all 16 combinations are allowed: TACG...TACG, tACG...TACG, taCG...TACG, tacG...TACG, ..., taCG...TACg, taCG...TAcg, taCG...Tacg, ..., tacg...tacg).

Acknowledgments

V.V. and S.L. were supported in part by NSF CAREER IIS-0447773, and NSF DBI-0321756. H.J. was supported in part by NSF CAREER MCB-0642843 and AES-CE Research Allocation Award PPA-7517H.

The authors would like to thank Shou-Wei Ding (Department of Plant Pathology, UC Riverside) and Sarjeet Gill (Cell Biology and Entomology) for kindly providing the additional pyrosequencing data, and Thomas Girke (Botany and Plant Biology) and Christian Shelton (Computer Science and Engineering) for useful discussions.